Quick Order

Human ULBP2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ULBP2 cDNA Clone Product Information
NCBI RefSeq:BC034689
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Homo sapiens UL16 binding protein 2 with C terminal Flag tag.
Gene Synonym:N2DL2, RAET1H, ULBP2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-ULBP2-flag
Restriction Site:KpnI + XbaI (6kb + 0.78kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ULBP2 Gene Plasmid Map
Human ULBP2 natural ORF mammalian expression plasmid, C-Flag tag
Human ULBP2 Gene Expression validated Image
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human ULBP2 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

NKG2D ligand 2, also known as N2DL-2, NKG2DL2, ALCAN-alpha, Retinoic acid early transcript 1H, UL16-binding protein 2, ULBP2 and N2DL2, is cell membrane protein which belongs to the MHC class I family. ULBP2 / N2DL-2 is expressed in various types of cancer cell lines and in the fetus, but not in normal tissues. ULBP2 / N2DL-2 is a ligand for the NKG2D receptor, together with at least ULBP1 and ULBP3. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway.

References
  • Cosman D. et al., 2001,Immunity 14:123-133
  • Cerwenka A., et al., 2003, Tissue Antigens 61:335-343
  • Chang,Y.T. et al., 2011, PLoS One. 6 (5):e20029
  • Size / Price
    Catalog: HG12143-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"