After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KLK6 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK6 cDNA Clone Product Information
Gene_bank_ref_id:BC015525
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 6 with C terminal Flag tag.
Gene Synonym:hK6, Bssp, Klk7, SP59, PRSS9, PRSS18, MGC9355, KLK6
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-KLK6-flag
Restriction Site:KpnI + XbaI (6kb + 0.77kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

KLK6 (kallikrein-related peptidase 6), also known as Klk7, belongs to the peptidase S1 family, Kallikrein subfamily. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. KLK6 is a serine protease which exhibits a preference for Arg over Lys in the substrate P1 position and for Ser or Pro in the P2 position. Klk7 shows activity against amyloid precursor protein, myelin basic protein, gelatin, casein and extracellular matrix proteins such as fibronectin, laminin, vitronectin and collagen. KLK6 degrades alpha-synuclein and prevents its polymerization, indicating that KLK6 may be involved in the pathogenesis of Parkinson disease and other synucleinopathies. Klk7 may be involved in regulation of axon outgrowth following spinal cord injury. Tumor cells treated with a neutralizing KLK6 antibody migrate less than control cells, suggesting a role in invasion and metastasis.

References
  • Krenzer S, et al. (2011) Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J Invest Dermatol. 131(11):2281-8.
  • Nathalie HV, et al. (2009) High kallikrein-related peptidase 6 in non-small cell lung cancer cells: an indicator of tumour proliferation and poor prognosis. J Cell Mol Med. 13(9B):4014-22.
  • Kim JT, et al. (2011) Up-regulation and clinical significance of serine protease kallikrein 6 in colon cancer. Cancer. 117(12):2608-19.
  • Scarisbrick IA, et al. (2011) Functional role of kallikrein 6 in regulating immune cell survival. PLoS One. 6(3):e18376.
  • Size / Price
    Catalog: HG12142-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"