After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AMICA1cDNA Clone Product Information
cDNA Size:1185
cDNA Description:ORF Clone of Homo sapiens adhesion molecule, interacts with CXADR antigen 1, transcript variant 1 DNA.
Gene Synonym:JAML, AMICA, Gm638, CREA7-1, CREA7-4, FLJ37080, MGC118814, MGC118815, AMICA1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10120-ACG$325
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10120-ACR$325
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10120-CF$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10120-CH$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10120-CM$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10120-CY$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10120-M$95
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10120-M-F$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10120-M-N$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10120-NF$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10120-NH$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10120-NM$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10120-NY$295
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10120-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Junctional adhesion molecules (JAMs) are endothelial and epithelial adhesion molecules involved in the recruitment of circulating leukocytes to inflammatory sites. JAML (Junctional adhesion molecule-like), also known as AMICA1 (Adhesion molecule interacting with CXADR antigen 1), a protein related to the JAM family, is restricted to leukocytes and promotes their adhesion to endothelial cells. It contains 2 extracellular immunoglobulin-like domains, a transmembrane segment, and a cytoplasmic tail involved in activation signaling. Monocytic JAML/AMICA1 plays a critical role in regulating monocyte transendothelial migration (TEM) probably via binding to the endothelial coxsackie and adenovirus receptor (CAR) and other tight junction-associated adhesive molecules. The Expression of JAML/AMICA1 is restricted to the hematopoietic tissues with the exception of liver. JAML may function in transmigration of leukocytes through epithelial and endothelial tissues. Expressed at the plasma membrane of polymorphonuclear leukocytes, JAML/AMICA1 also enhances myeloid leukemia cell adhesion to endothelial cells.

  • Moog-Lutz C, et al. (2003) JAML, a novel protein with characteristics of a junctional adhesion molecule, is induced during differentiation of myeloid leukemia cells. Blood. 102(9): 3371-8.
  • Luissint AC, et al. (2008) JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by alpha4beta1 integrin activation. J Cell Biol. 183(6): 1159-73.
  • Guo YL, et al. (2009) Role of junctional adhesion molecule-like protein in mediating monocyte transendothelial migration. Arterioscler Thromb Vasc Biol. 29(1): 75-83.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items