Quick Order

Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDC42cDNA Clone Product Information
Gene_bank_ref_id:NM_001039802.1
cDNA Size:576
cDNA Description:ORF Clone of Homo sapiens cell division cycle 42 (GTP binding protein, 25kDa), transcript variant 3 DNA.
Gene Synonym:CDC42, G25K, CDC42Hs
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10062-ACG$325
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10062-ACR$325
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10062-CF$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10062-CH$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10062-CM$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10062-CY$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG10062-M$195
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10062-M-F$395
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10062-NF$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10062-NH$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10062-NM$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10062-NY$295
Human CDC42 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10062-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
et al.
  • Shinjo K, et al. (1990) Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42. Proc Natl Acad Sci. 87(24):9853-7.
  • Munemitsu S, et al. (1990) Molecular cloning and expression of a G25K cDNA, the human homolog of the yeast cell cycle gene CDC42. Mol Cell Biol. 10(11):5977-82.
  • Walker S J, et al. (2000) Activation of phospholipase D1 by Cdc42 requires the Rho insert region. J Biol Chem. 275(21):15665-8.
  • Low B C, et al. (1999) Tyrosine phosphorylation of the Bcl-2-associated protein BNIP-2 by fibroblast growth factor receptor-1 prevents its binding to Cdc42GAP and Cdc42. J Biol Chem. 274(46): 33123-30.
  • Zhang B, et al. (1998) Interaction of Rac1 with GTPase-activating proteins and putative effectors. A comparison with Cdc42 and RhoA. J Biol Chem. 273(15):8776-82.
  • Size / Price
    Catalog:HG10062-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"