Quick Order

Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPTcDNA Clone Product Information
Gene_bank_ref_id:NM_016841.2
cDNA Size:1059
cDNA Description:ORF Clone of Homo sapiens microtubule-associated protein tau (MAPT), transcript variant 4 DNA.
Gene Synonym:MAPT, TAU, MSTD, PPND, DDPAC, MAPTL, MTBT1, MTBT2, FTDP-17
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10058-ACG$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10058-ACR$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10058-ANG$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10058-ANR$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10058-CF$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10058-CH$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10058-CM$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10058-CY$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG10058-M$195
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10058-M-F$395
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10058-NF$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10058-NH$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10058-NM$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10058-NY$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10058-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

MAPT (microtubule-associated protein tau) can produce tau proteins. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons of the central nervous system and are less common elsewhere, but are also expressed at very low levels in CNS astrocytes and oligodendrocytes. When tau proteins are defective, and no longer stabilize microtubules properly, they can result in dementias such as Alzheimer's disease. Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared to non-neuronal cells. One of tau's main functions is to modulate the stability of axonal microtubules. Other nervous system MAPs may perform similar functions, as suggested by tau knockout mice, who did not show abnormalities in brain development - possibly because of compensation in tau deficiency by other MAPs.

References
  • Harada A, et al. (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature. 369(6480):488-91.
  • Weingarten MD, et al. (1975) A protein factor essential for microtubule assembly. Proc Natl Acad Sci. 72(5):1858-62.
  • Goedert M, et al. (1989) Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 3(4): 519-26.
  • Size / Price
    Catalog:HG10058-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"