After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GSK3BcDNA Clone Product Information
cDNA Size:1302
cDNA Description:ORF Clone of Homo sapiens glycogen synthase kinase 3 beta DNA.
Gene Synonym:GSK3B
Restriction Site:KpnI + XbaI
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10044-ACG$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10044-ACR$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10044-ANG$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10044-ANR$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10044-CF$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10044-CH$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10044-CM$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10044-CY$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone)HG10044-M$195
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10044-NF$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10044-NH$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10044-NM$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10044-NY$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10044-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

  • Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3β induces dermal fibrosis by activation of the canonical Wnt pathway. Ann Rheum Dis. 70(12):2191-8.
  • Ban JO, et al. (2011) Troglitazone, a PPAR agonist, inhibits human prostate cancer cell growth through inactivation of NFκB via suppression of GSK-3β expression. Cancer Biol Ther. 12(4):288-96.
  • Tsukigi M, et al. (2012) Re-expression of miR-199a suppresses renal cancer cell proliferation and survival by targeting GSK-3β. Cancer Lett. 315(2):189-97.
  • Nandan D, et al. (2012) Myeloid cell IL-10 production in response to leishmania involves inactivation of glycogen synthase kinase-3β downstream of phosphatidylinositol-3 kinase. J Immunol. 188(1):367-78.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items