After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RELAcDNA Clone Product Information
Gene_bank_ref_id:NM_021975
cDNA Size:1695
cDNA Description:ORF Clone of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) DNA.
Gene Synonym:p65
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:KpnI + XbaI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12054-ACG$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12054-ACR$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12054-ANG$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12054-ANR$345
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12054-CF$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12054-CH$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12054-CM$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12054-CY$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone)HG12054-G$125
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12054-NF$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12054-NH$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12054-NM$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12054-NY$315
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12054-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

References
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"