After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TPM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPM1cDNA Clone Product Information
cDNA Size:846
cDNA Description:ORF Clone of Mus musculus ancient ubiquitous protein 1 DNA.
Gene Synonym:AA589454
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

TPM1, also known as tropomyosin-1, is a member of the tropomyosin family. Members of this family are highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM1 is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle. It binds to actin filaments in muscle and non-muscle cells. TPM1 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction.

  • Mogensen J. et al., 1999, Cytogenet Cell Genet. 84 (1-2): 35-6.
  • Brown H R. et al., 1985, Proc Natl Acad Sci. 82 (8): 2359-63.
  • Lees-Miller JP. et al., 1992, BioEssays. 13 (9): 429-37.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items