After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTGS2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTGS2 cDNA Clone Product Information
Gene_bank_ref_id:NM_000963
RefSeq ORF Size:1815bp
cDNA Description:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) with C terminal Flag tag.
Gene Synonym:COX2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-PTGS2-Flag
Restriction Site:KpnI + XbaI (6kb + 1.85kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTGS2 Gene Plasmid Map
Human PTGS2 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

References
  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Catalog: HG12036-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"