Quick Order

Mouse BCL11A natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse BCL11A cDNA Clone Product Information
NCBI RefSeq:NM_001159290.1
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Mus musculus B cell CLL/lymphoma 11A (zinc finger protein).
Gene Synonym:Evi9, Ctip1, Evi9a, Evi9b, Evi9c, BCL-11A, mKIAA1809, 2810047E18Rik, D930021L15Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG52551-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"