Quick Order

Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VCLcDNA Clone Product Information
Gene_bank_ref_id:NM_003373.3
cDNA Size:3201
cDNA Description:ORF Clone of Homo sapiens vinculin (VCL), transcript variant 2 DNA.
Gene Synonym:VCL, MVCL, CMD1W, Vin
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10019-ACG$425
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10019-ACR$425
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10019-ANG$425
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10019-ANR$425
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10019-CF$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10019-CH$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10019-CM$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10019-CY$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10019-M$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10019-M-F$645
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10019-NF$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10019-NH$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10019-NM$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10019-NY$395
Human vinculin transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10019-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Vinculin (VCL) is a cytoskeletal protein that is closely related to both cell-matrix interactions and cell-cell junctions. VCL is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. This protein has multi-ligand properties and has been found to interact with a number of microfilament associated proteins, such as talin, a-actinin, and paxillin, which reportedly bind to either the head or tail domains of vinculin.

References
  • Massoumi R, et al. (2001) Leukotriene D(4) affects localisation of vinculin in intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events. J Cell Sci. 114(10): 1925-34.
  • Turner CE, et al. (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci. 107 (6): 1583-91.
  • Strasser P, et al. (1993) Variable and constant regions in the C-terminus of vinculin and metavinculin: cloning and expression of fragments in E. coli. FEBS Lett. 317: 189-194.
  • Size / Price
    Catalog:HG10019-NF
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"