Quick Order

Human SMOC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SMOC1cDNA Clone Product Information
Gene_bank_ref_id:NM_001034852.1
cDNA Size:1308
cDNA Description:ORF Clone of Homo sapiens SPARC related modular calcium binding 1 DNA.
Gene Synonym:SMOC1
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

SPARC-related modular calcium-binding protein 1, also known as secreted modular calcium-binding protein 1 and SMOC1, is a member of the SPARC family. SMOC1 is widely expressed in many tissues with a strongest signal in ovary. It contains two EF-hand domains, one Kazal-like domain and two thyroglobulin type-1 domains. Extracellular matrix proteins have been implicated in the regulation of osteoblast differentiation of bone marrow derived mesenchymal stem cells (BMSCs) through paracrine or autocrine mechanisms. SMOC1 is a regulator of osteoblast differentiation of BMSCs. SMOC1 is highly expressed and secreted in BMSCs stimulated with osteogenic medium (OSM). SMOC1 and SMOC2 are matricellular proteins thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SMOC1 and SMOC2 may mediate intercellular signaling and cell type-specific differentiation during gonad and reproductive tract development.

References
  • Vannahme C. et al., 2002 J. Biol. Chem. 277:37977-86.
  • Pazin,D.E. et al., 2009, Dev Dyn. 238 (11): 2877-90.
  • Choi,Y.A. et al., 2010, J Proteome Res. 9 (6):2946-56.
  • Size / Price
    Catalog:HG12026-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"