After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PVRL2cDNA Clone Product Information
cDNA Size:1617
cDNA Description:ORF Clone of Homo sapiens poliovirus receptor-related 2 (herpesvirus entry mediator B), transcript variant delta DNA.
Gene Synonym:PVRL2, HVEB, PRR2, CD112, PVRR2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged  on other vectors
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged HG10005-ACG$345
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone) , expression ready, C-OFPSpark tagHG10005-ACR$345
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged HG10005-CF$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged HG10005-CH$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged HG10005-CM$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged HG10005-CY$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone) HG10005-G$195
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged HG10005-NF$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged HG10005-NH$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged HG10005-NM$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged HG10005-NY$315
Human CD112 / Nectin2 transcript variant delta Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10005-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks