Quick Order

Human UBE2E1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBE2E1cDNA Clone Product Information
cDNA Size:572
cDNA Description:ORF Clone of Homo sapiens ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) DNA.
Gene Synonym:UBCH6, UBE2E1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Ubiquitin-conjugating enzyme E2E1 (UBE2E1) is a member of the ubiquitin-donjugating enzyme family. UBE2E1 is a protein localized to the nucleus. The modification of proteins with ubiquitin is an importantly step for targeting abnormal or short-lived proteins for degeneration. It has been demonstrated to be released to Sjogrens's syndrome and systemic lupus Erythematosus. Patients with the systemic autoimmune diseases Sjogrens's syndrome and systemic lupus erythematosus often have autoantibodies against the intracellular protein Ro52 that is an E3 ligase dependent on the ubiquitin conjugation enzymes UBE2E1. Ro52 mediates ubiquitination through UBE2D1 in the cytoplasm and through UBE2E1 in the nucleus.

  • Nuber U, et al. (1996) Cloning of human ubiquitin-conjugating enzymes UbcH6 and UbcH7 (E2-F1) and characterization of their interaction with E6-AP and RSP5. J Biol Chem. 271(5): 2795-800.
  • Espinosa A, et al. (2008) The autoantigen Ro52 is an E3 ligase resident in the cytoplasm but enters the nucleus upon cellular exposure to nitric oxide. Exp Cell Res. 314(20): 3605-13.
  • Anan T, et al. (1998) Human ubiquitin-protein ligase Nedd4: expression, subcellular localization and selective interaction with ubiquitin-conjugating enzymes. Genes Cells. 3(11): 751-63.