Quick Order

Text Size:AAA

Human VNN2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VNN2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004665.2
RefSeq ORF Size:1563bp
cDNA Description:Full length Clone DNA of Homo sapiens vanin 2 with C terminal Flag tag.
Gene Synonym:FOAP-4, GPI-80
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Vascular non-inflammatory molecule 2, also known as glycosyl-phosphatidyl inositol-anchored protein GPI-80, Vanin-2, Protein FOAP-4 and VNN2, is a cell membrane protein which belongs to the CN hydrolase family and Vanin subfamily. VNN2 is widely expressed with higher expression in spleen and blood. VNN2 is a member of the vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. VNN2 is an amidohydrolase that hydrolyzes specifically one of the carboamide linkages in D-pantetheine thus recycling pantothenic acid (vitamin B5) and releasing cysteamine. It is involved in the thymus homing of bone marrow cells. VNN2 plays a role in transendothelial migration of neutrophils and may regulate beta-2 integrin-mediated cell adhesion, migration and motility of neutrophil.

References
  • Suzuki K. et al., 1999, J. Immunol. 162: 4277-84.
  • Martin, F. et al., 2001,Immunogenetics. 53 (4):296-306.
  • Liu T.et al., 2005, J. Proteome Res. 4: 2070-80.
  • Jansen P.AM. et al., 2009, J. Invest. Dermatol. 129: 2167-74.
  • Size / Price
    Catalog: HG11728-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"