After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRKD2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_016457.4
RefSeq ORF Size:2634bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase D2PRKD2 protein kinase D2 with C terminal Flag tag.
Gene Synonym:PKD2, HSPC187
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Serine/threonine-protein kinase D2, also known as PRKD2 and PKD2, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD2 / PKD2 is widely expressed. It contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. PRKD2 / PKD2 is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains bind DAG, mediating translocation to membranes. Autophosphorylation of Ser-710 and phosphorylation of Ser-706 by PKC relieves auto-inhibition by the PH domain. PRKD2 / PKD2 converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. Involved in resistance to oxidative stress.

References
  • Zhang QH, et al., 2000, Genome Res 10 (10): 1546-60.
  • Di Bernardo MC, et al.,2008, Nature genetics. 40 (10) :1204-10.
  • Zhang L, et al., 2009, American journal of nephrology. 30 (6) :505-13.
  • Size / Price
    Catalog: HG11671-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"