Quick Order

Text Size:AAA

Human TREML2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TREML2 cDNA Clone Product Information
Gene_bank_ref_id:NM_024807.2
RefSeq ORF Size:966bp
cDNA Description:Full length Clone DNA of Homo sapiens triggering receptor expressed on myeloid cells-like 2 with C terminal Flag tag.
Gene Synonym:TLT2, C6orf76, FLJ13693, MGC149715, MGC149716, dJ238O23.1, TREML2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I  membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

References
  • Mungall A.J. et al., 2003, Nature. 425: 805-11.
  • Clark HF. et al., 2003, Genome Res. 13: 2265-70.
  • The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.
  • Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.
  • Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.
  • Size / Price
    Catalog: HG11655-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"