Quick Order

Human AIM2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AIM2cDNA Clone Product Information
Gene_bank_ref_id:NM_004833.1
cDNA Size:1032
cDNA Description:ORF Clone of Homo sapiens absent in melanoma 2 DNA.
Gene Synonym:PYHIN4, AIM2
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal pyrin domain and a carboxy-terminal oligonucleotide/oligosaccharide-binding domain, senses cytoplasmic DNA by means of its oligonucleotide/oligosaccharide-binding domain and interacts with ASC (apoptosis-associated speck-like protein containing a CARD) through its pyrin domain to activate caspase-1. In response to foreign cytoplasmic DNA, AIM2 forms an inflammasome, resulting in caspase activation in inflammatory cells. It had been pointed to a role of AIM2 function in both inflammation and cancer. AIM-2 antigen is expressed in a wide variety of tumor types, including neuroectodermal tumors, as well as breast, ovarian and colon carcinomas. AIM-2 could be used as a tumor antigen target for monitoring vaccine trials or to develop antigen specific active immunotherapy for glioma patients.

References
  • Patsos G, et al. (2010) Restoration of absent in melanoma 2 (AIM2) induces G2/M cell cycle arrest and promotes invasion of colorectal cancer cells. Int J Cancer. 126(8): 1838-49.
  • Fernandes-Alnemri T, et al. (2009) AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 458(7237): 509-13.
  • Chen IF, et al. (2006) AIM2 suppresses human breast cancer cell proliferation in vitro and mammary tumor growth in a mouse model. Mol Cancer Ther. 5(1): 1-7.
  • Liu G, et al. (2004) AIM-2: a novel tumor antigen is expressed and presented by human glioma cells. J Immunother. 27(3): 220-6.
  • Size / Price
    Catalog:HG11654-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"