After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Canine NGFR / TNFRSF16 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine NGFR cDNA Clone Product Information
Gene_bank_ref_id:XM_003435627.1
RefSeq ORF Size:339bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris nerve growth factor receptor with N terminal Flag tag.
Gene Synonym:NGFR, TNFRSF16
Species:Canine
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Background

Nerve growth factor receptors (NGFRs) belong to a large growth factor receptor family. NGFR includes two types of receptors: high-affinity nerve growth factor receptor and low-affinity nerve growth factor receptor. High-affinity nerve growth factor receptor is also referred as Trk familywhose members are bound by some neurotrophins with high affinity. Nerve growth factor binds with TrkA after being released from target cells, the NGF / TrkA complex is subsequently trafficked back to the cell body. The Low-affinity nerve growth factor receptor also named p75 which binds with all kinds of neurotrophins with low affinity. All the four kinds of neurotrophins, including Nerve growth factor, Brain derived neurotrophic factor, Neurotrophin-3, and Neurotrophin-4 bind to the p75. Studies have proved that NGFR acts as a molecular signal swith that determines cell death or survival by three steps. First, pro-nerve growth factor (prNGF) triggers cell apoptosis by its high affinity binding to p75NTR, while NGF induces neuronal survival with low-affinity binding. Second, p75NTR mediates cell death by combining with co-receptor sortilin, whereas it promotes neuronal survival through combination with proNGF. Third, release of the intracellular domain chopper or cleavage short p75 NTR can independently initiate neuronal apoptosis.

References
  • Chen LW, et al. (2008) The proNGF-p75NTR-sortilin signalling complex as new target for the therapeutic treatment of Parkinson's disease. CNS Neurol Disord Drug Targets. 7(6): 512-23.
  • Deponti D, et al. (2009) The low-affinity receptor for neurotrophins p75NTR plays a key role for satellite cell function in muscle repair acting via RhoA. Mol Biol Cell.20(16): 3620-7.
  • Ken-ichiro K, et al. (2004) Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem. 279 (3): 1703-12.
  • Size / Price
    Catalog: DG70089-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"