Quick Order

Text Size:AAA

Mouse ATP5D natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ATP5D cDNA Clone Product Information
NCBI RefSeq:NM_025313.2
RefSeq ORF Size:507bp
cDNA Description:Full length Clone DNA of Mus musculus ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit.
Gene Synonym:C85518, AA960090, AI876556, AU020773, 0610008F14Rik, 1500000I11Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ATP5D is a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase consists of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). ATP5D gene encodes the delta subunit of the catalytic core.

References
  • Jordan EM. et al., 1992, Biochim Biophys Acta 1130 (1): 123-6.
  • Yoshida M. et al., 2001, Nat Rev Mol Cell Biol. 2 (9): 669-77.
  • Hochstrasser DF. et al., 1993, Electrophoresis. 13 (12): 992-1001.
  • Size / Price
    Catalog: MG52204-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"