Quick Order

Mouse ALDH7A1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ALDH7A1 cDNA Clone Product Information
Gene_bank_ref_id:BC012407.1
RefSeq ORF Size:1536bp
cDNA Description:Full length Clone DNA of Mus musculus aldehyde dehydrogenase family 7, member A1.
Gene Synonym:Atq1, D18Wsu181e
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.

References
  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.
  • Size / Price
    Catalog: MG52196-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"