After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PLS3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLS3cDNA Clone Product Information
Gene_bank_ref_id:NM_001166453.1
cDNA Size:1893
cDNA Description:ORF Clone of Mus musculus plastin 3 (T-isoform) DNA.
Gene Synonym:AI115446, AL024105, T-fimbrin
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

PLS3, also known as plastin 3, belongs to the plastin family. Members of this family are actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. There are two ubiquitous plastin isoforms in humans: L and T. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). PLS3 contains 2 actin-binding domains, 4 CH (calponin-homology) domains and 2 EF-hand domains. It is expressed in a variety of organs, including muscle, brain, uterus and esophagus.

References
  • Lin CS. et al., 1993, J Biol Chem 268 (4): 2781-92.
  • Goldstein D. et al., 1985, Cancer Res. 45 (2): 5643-7.
  • Arpin M. et al., 1995, J Cell Biol. 127 (2): 1995-2008.
  • Size / Price
    Catalog:MG52182-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"