After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human STIM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STIM1cDNA Clone Product Information
cDNA Size:2058
cDNA Description:ORF Clone of Homo sapiens stromal interaction molecule 1 DNA.
Gene Synonym:GOK, D11S4896E, STIM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Stromal interaction molecule 1, also known as STIM1 and GOK, is a cell membrane, a single-pass type I  membrane protein and a endoplasmic reticulum membrane protein. STIM1 / GOK is ubiquitously expressed in various human primary cells and tumor cell lines. It contains one EF-hand domain and one SAM (sterile alpha motif) domain. STIM1 / GOK plays a role in mediating Ca2+ influx following depletion of intracellular Ca2+ stores. It acts as Ca2+ sensor in the endoplasmic reticulum via its EF-hand domain. Upon Ca2+ depletion, STIM1 / GOK translocates from the endoplasmic reticulum to the plasma membrane where it activates the Ca2+ release-activated Ca2+ (CRAC) channel subunit, TMEM142A / ORAI1. Transfection of STIM1 / GOK into cells derived from a rhabdoid tumor and from a rhabdomyosarcoma that do not express detectable levels of STIM1 can induce cell death, suggesting a possible role in the control of rhabdomyosarcomas and rhabdoid tumors. Defects in STIM1 are the cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 2 (IDTICED2) which is an immune disorder characterized by recurrent infections, impaired T-cell activation and proliferative response, decreased T-cell production of cytokines, lymphadenopathy, and normal lymphocytes counts and serum immunoglobulin levels.

  • Sabbioni S. et al., 1997, Cancer Res. 57: 4493-7.
  • Manji S.S. et al., 2000, Biochim. Biophys. Acta 1481: 147-55.
  • Williams R.T. et al., 2002, Biochim. Biophys. Acta. 1596: 131-7.
  • Spassova M.A. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 4040-5.
  • Parvez S. et al., 2008, FASEB J. 22: 752-61.