After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human B3GNT2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human B3GNT2 cDNA Clone Product Information
Gene_bank_ref_id:NM_006577.5
RefSeq ORF Size:1194bp
cDNA Description:Full length Clone DNA of Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 with C terminal Flag tag.
Gene Synonym:B3GN-T2, B3GNT, B3GNT-2, B3GNT1, BETA3GNT, BGNT2, BGnT-2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

B3GNT2 belongs to the beta-1,3-N-acetylglucosaminyltransferase family. It is a type II transmembrane protein which prefers the substrate of lacto-N-neotetraose. Alternative splicing produced 2 isoforms of the human protein. B3GNT2 catalyzes the initiation and elongation of poly-N- acetyllactosamine chains. Enzymatic activities of some glycosyltransferases are markedly increased via complex formation with other transferases or cofactor proteins. B3GNT2 and beta3Gn-T8 can form a heterodimer in vitro and that the complex exhibits much higher enzymatic activity than either enzyme alone. It is found that up-regulation of beta3Gn-T8 in differentiated HL-60 cells may increases poly-N-acetyllactosamine chains by activating intrinsic B3GNT2.

References
  • Australo-An, et al. (2010) Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. Nat Genet. 42(2):123-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Seko A, et al. (2008) Activation of beta1,3-N-acetylglucosaminyltransferase-2 (beta3Gn-T2) by beta3Gn-T8. Possible involvement of beta3Gn-T8 in increasing poly-N-acetyllactosamine chains in differentiated HL-60 cells. J Biol Chem. 283(48):33094-100.
  • Size / Price
    Catalog: HG11416-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"