Quick Order

Text Size:AAA

Mouse DDOST Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DDOSTcDNA Clone Product Information
cDNA Size:1326
cDNA Description:ORF Clone of Mus musculus dolichyl-di-phosphooligosaccharide-protein glycotransferase DNA.
Gene Synonym:Ddost
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

The enzyme oligosaccharyltransferase (dolichyl-diphosphooligosaccharide-protein glycosyltransferase) (DDOST), or 48-kDa subunit (OST48) is one of the catalytic subunits in this complex, exerts a typical type I membrane topology, containing a large luminal domain, a hydrophobic transmembrane domain and a short cytosolic peptide tail. DDOST/OST48 catalyzes the transfer of a high-mannose oligosaccharide (GlcNac2Man9Glc3) from a dolichol-linked oligosaccharide donor (dolichol-P-GlcNac2Man9Glc3) onto the asparagine acceptor site within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains across the membrane of the endoplasmic reticulum. The mammalian oligosaccharyltransferase (OST) is an oligomeric complex composed of three type I transmembrane proteins of the endoplasmic reticulum: ribophorin I (RI), ribophorin II (RII), and OST48. OST48 is not a glycoprotein and is not recognized by antibodies to either ribophorin. Like ribophorins I and II, OST48 was found to be an integral membrane protein, with the majority of the polypeptide located within the lumen of the endoplasmic reticulum (ER). OST48 does not show significant amino acid sequence homology to either ribophorin I or II. It had been found that only the luminal domain of RI contains ER retention information. The dilysine motif in OST48 functions as an ER localization motif because OST48 in which the two lysine residues are replaced by serine (OST48ss) is no longer retained in the ER and is found instead also at the plasma membrane.

  • Silberstein S, et al. (1992) The 48-kDa subunit of the mammalian oligosaccharyltransferase complex is homologous to the essential yeast protein WBP1. J Biol Chem. 267(33): 23658-63.
  • Fu J, et al. (1997) Interactions among subunits of the oligosaccharyltransferase complex. J Biol Chem. 272(47): 29687-92.
  • Yamagata T, et al. (1997) Genomics. Genome organization of human 48-kDa oligosaccharyltransferase (DDOST). 45(3): 535-40.
  • Fu J, et al. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J Biol Chem. 275(6): 3984-90.
  • Hardt B, et al. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol Chem. 382(7): 1039-47.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items