Quick Order

Text Size:AAA

Mouse CCDC47 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCDC47cDNA Clone Product Information
Gene_bank_ref_id:NM_026009.2
cDNA Size:1452
cDNA Description:ORF Clone of Mus musculus coiled-coil domain containing 47 DNA.
Gene Synonym:asp4, C88307, calumin, 2610204L23Rik, RP23-81G14.10
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

CCDC47 gene is expressed at high level. The gene contains 16 distinct gt-ag introns. Transcription produces 9 different mRNAs, 6 alternatively spliced variants and 3 unspliced forms. There are 3 probable alternative promotors, 3 non overlapping alternative last exons and 8 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of a cassette exon, overlapping exons with different boundaries. Functionally, CCDC47 gene has been proposed to participate in processes such as calcium ion homeostasis, embryo development, ER overload response and post-embryonic development. CCDC47 are expected to have molecular function (calcium ion binding) and to localize in various compartments (membrane, endoplasmic reticulum, integral to membrane, microsome).

References
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog:MG52105-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"