Quick Order

Text Size:AAA

Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CMBLcDNA Clone Product Information
cDNA Size:738
cDNA Description:ORF Clone of Homo sapiens carboxymethylenebutenolidase homolog (Pseudomonas) DNA.
Gene Synonym:FLJ23617, CMBL
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11404-ACG$325
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11404-ACR$325
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11404-ANG$325
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11404-ANR$325
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11404-CF$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11404-CH$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11404-CM$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11404-CY$295
Human CMBL Gene cDNA Clone (full-length ORF Clone)HG11404-M$95
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11404-M-F$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11404-M-N$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11404-NF$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11404-NH$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11404-NM$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11404-NY$295
Human CMBL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11404-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a hydrolase specially belonging to the family of hydrolases. It maily acts on carboxylic ester bonds. CMBL is a human homolog of Pseudomonas dienelactone hydrolase involved in the bacterial halocatechol degradation pathway. The ubiquitous expression of human CMBL gene transcript in various tissues was observed. CMBL was demonstrated to be the primary olmesartan medoxomil (OM) bioactivating enzyme in the liver and intestine. The recombinant human CMBL expressed in mammalian cells was clearly shown to activate OM. The recombinant CMBL also converted other prodrugs having the same ester structure as OM, faropenem medoxomil and lenampicillin, to their active metabolites. CMBL exhibited a unique sensitivity to chemical inhibitors, thus, being distinguishable from other known esterases.  

  • Ishizuka T, et al. (2010) Human Carboxymethylenebutenolidase as a Bioactivating Hydrolase of Olmesartan Medoxomil in Liver and Intestine. The Journal of Biological Chemistry. 285: 11892-902.
  • Schmidt E, et al. (1980) Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem J. 192 (1): 339-47.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items