After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ALDH1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALDH1A1cDNA Clone Product Information
cDNA Size:1506
cDNA Description:ORF Clone of Homo sapiens aldehyde dehydrogenase 1 family, member A1 DNA.
Gene Synonym:ALDC, ALDH1, PUMB1, ALDH11, RALDH1, ALDH-E1, MGC2318, ALDH1A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ALDH1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that help maintain the transparency of the cornea. Increased ALDH1A1 activity has been found in the stem cell populations of leukemia and some solid tumors. In tumor specimens, increased ALDH1A1 immunopositivity was found not only in secretory type cancer epithelial cells but also in neuroendocrine tumor populations. ALDH1 has been identified as a reliable marker of breast cancer stem cells. ALDH1 expression in primary cancer is an independent prognostic factor in node-positive breast cancer patients. ALDH1A1 plays a key role in normal hematopoiesis, and as a TLX1 transcriptional target, ALDH1A1 may contribute to the ability of this homeoprotein to alter cell fate and induce tumor growth.

  • Li T, et al. (2010). ALDH1A1 is a marker for malignant prostate stem cells and predictor of prostate cancer patients' outcome. Lab Invest. 90(2): 234-44.
  • Levi BP, et al. (2009) Aldehyde dehydrogenase 1a1 is dispensable for stem cell function in the mouse hematopoietic and nervous systems. Blood. 113(8): 1670-80.
  • Rahman FB, et al. (2006) Uncompetitive inhibition of Xenopus laevis aldehyde dehydrogenase 1A1 by divalent cations. Zoolog Sci. 23(3): 239-44.
  • Jester JV, et al. (1999). The cellular basis of corneal transparency: evidence for corneal crystallins. J Cell Sci. 112 ( Pt 5): 613-22.