After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus H1F0 ORF mammalian expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus H1F0 cDNA Clone Product Information
NCBI RefSeq:XM_001088913.2
RefSeq ORF Size:585bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) H1 histone family, member 0 with N terminal Flag tag.
Gene Synonym:H1F0
Species:Rhesus
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

H1 histone family, member 0 (H1F0) is a member of the H1 histone family of nuclear proteins which are a component of chromatin in eukaryotic cells. It's involved in maintaining the structure of chromatin by packing the "beads on a string" sub-structure into a high order structure. The lysine-rich H1 histone family in mammals includes eleven members. In higher eukaryotes all H1 variants have the same general structure, consisting of a central conserved globular domain and less conserved N-terminal and C-terminal tails. These tails are moderately conserved among species, but differ among variants, suggesting a specific function for each H1 variant. Studies on the role of particular subtypes at specific developmental stages in lower eukaryotes, but also in vertebrates suggest that specific subtypes of H1 participate in particular systems of gene regulation. 

References
  • Ramakrishnan V, et al. (1993) Crystal structure of globular domain of histone H5 and its implications for nucleosome binding. Nature. 362 (6417): 219-23.
  • Happel N, et al. (2009) Histone H1 and its isoforms: contribution to chromatin structure and function. Gene. 431 (1-2): 1-12.
  • Izzo A, et al. (2008) The histone H1 family: specific members, specific functions. Biol Chem. 389 (4): 333-43.
  • Size / Price
    Catalog: CG90787-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"