Quick Order

Mouse GNAS natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GNAS cDNA Clone Product Information
Gene_bank_ref_id:NM_201616.1
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Mus musculus GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus.
Gene Synonym:P1, P2, P3, GSP, Gsa, POH, GPSA, Nesp, Gnas1, Nespl, PHP1A, PHP1B, Gnasxl, Oedsml, Galphas, Oed-Sml, 5530400H20Rik, A930027G11Rik, C130027O20Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG52037-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"