Quick Order

Text Size:AAA

Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIST2H2BEcDNA Clone Product Information
cDNA Size:381
cDNA Description:ORF Clone of Homo sapiens histone cluster 2, H2be DNA.
Gene Synonym:H2B, H2BQ, GL105, H2B.1, H2BFQ, H2BGL105, MGC119802, MGC119804, MGC129733, MGC129734, HIST2H2BE
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11362-ACG$325
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11362-ACR$325
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11362-ANG$325
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11362-ANR$325
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11362-CF$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11362-CH$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11362-CM$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11362-CY$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone)HG11362-M$95
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11362-M-F$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11362-M-N$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11362-NF$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11362-NH$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11362-NM$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11362-NY$295
Human HIST2H2BE Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11362-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. Histone proteins exhibit two levels of diversity: 1. evolutionary diversity between species and 2. subtype diversity in a class(H1, H2A, H2B, H3 or H4) within a species. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone H2B proteins have been studied in a variety of species and is easily detecred in most species. The reversible ubiquitylation of histone H2B has long been implicated in transcriptional activation and gene silencing. Phosphorylation of H2B serine 32 occurs in normal cycling and mitogen-stimulated cells. Notably, this phosphorylation is elevated in skin cancer cell lines and tissues compared with normal counterparts. HIST2H2BE is a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993). A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002). The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items