Quick Order

Text Size:AAA

Mouse RRP8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse RRP8 cDNA Clone Product Information
Gene_bank_ref_id:NM_025897.2
RefSeq ORF Size:1374bp
cDNA Description:Full length Clone DNA of Mus musculus ribosomal RNA processing 8, methyltransferase, homolog (yeast).
Gene Synonym:AW538116; 1500003O22Rik; 2900001K19Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mRRP8
Restriction Site:KpnI + NotI (6.1kb + 1.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse RRP8 Gene Plasmid Map
Mouse RRP8 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: MG51931-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"