After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FLRT3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FLRT3cDNA Clone Product Information
cDNA Size:1950
cDNA Description:ORF Clone of Mus musculus fibronectin leucine rich transmembrane protein 3 DNA.
Gene Synonym:mKIAA1469, 5530600M07Rik, C430047I10Rik
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Leucine-rich repeat transmembrane protein FLRT3, also known as Fibronectin-like domain-containing leucine-rich transmembrane protein 3, and FLRT3, is a single-pass type I membrane protein which belongs to the fibronectin leucine rich transmembrane protein (FLRT) family. FLRT3 contains one fibronectin type-III domain and ten LRR (leucine-rich) repeats and is expressed in kidney, brain, pancreas, skeletal muscle, lung, liver, placenta, and heart. It has a provocative expression pattern during somite development being expressed in regions of the somite where muscle precursor cells migrate from the dermomyotome and move into the myotome, and later in myotomal precursors destined to migrate towards their final destination. FLRT1, FLRT2 and FLRT3 are members of the FLRT family. The FLRT family of leucine-rich repeat (LRR) proteins is implicated in fibroblast growth factor (FGF) signalling, early embryonic development and neurite outgrowth. FLRT3 shares 55% amino acid sequence identity with FLRT1 and 44% identity with FLRT2. Two alternatively spliced transcript variants encoding the same protein have been described. The expression of FLRT3 is controlled by fibroblast growth factors (FGFs). FLRT3 has been implicated in neurite outgrowth after nerve damage, as a positive regulator of FGF signalling and in homotypic cell adhesion. FLRT3 may have a crucial role in regulating cellular adhesion between the epithelial apical ridge and the underlying mesenchyme and in establishing the dorso-ventral position of the ridge.

  • Smith TG, et al. (2006) The expression of Flrt3 during chick limb development. Int J Dev Biol. 50(8): 701-4.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 29(7): 497-502.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items