Quick Order

Text Size:AAA

Human SEMA5A ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SEMA5A cDNA Clone Product Information
Gene_bank_ref_id:NM_003966.2
RefSeq ORF Size:3225bp
cDNA Description:Full length Clone DNA of Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A with C terminal Flag tag.
Gene Synonym:semF, SEMAF, FLJ12815
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration. Semaphorin-5A, also known as Semaphorin-F, Sema F, SEMA5A and SEMAF, is a single-pass type I membrane protein which belongs to the semaphorin family. Semaphorin5A / SEMA5A contains one PSI domain, one Sema domain and seven TSP type-1 domains. It may act as positive axonal guidance cues. Semaphorin5A / SEMA5A is an axon regulator molecule and plays major roles during neuronal and vascular development. It plays an essential role in embryonic development. Semaphorin5A / SEMA5A induces endothelial cell migration from pre-existing vessels. It also plays a role in autism, reducing the ability of neurons to form connections with other neurons in certain brain regions.

References
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci.  99 (26): 16899-903.
  • Neufeld G. et al., 2005, Front Biosci. 10: 751-60.
  • Fiore R. et al., 2005, Mol Cell Biol. 25 (6): 2310-9.
  • Yazdani U. et al., 2006, Genome Biol. 7 (3): 211.
  • Sadanandam A. et al., 2010, Microvasc Res. 79 (1): 1-9.
  • Size / Price
    Catalog: HG11300-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"