After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AKR1B1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKR1B1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001628.2
RefSeq ORF Size:951bp
cDNA Description:Full length Clone DNA of Homo sapiens aldo-keto reductase family 1, member B1 (aldose reductase) with C terminal Flag tag.
Gene Synonym:AR, ADR, ALR2, ALDR1, MGC1804, AKR1B1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Aldose reductase (AKR1B1) belongs to the aldo/keto reductase superfamily. AKR1B1 is a NADPH-dependent aldo-keto reductase best known as the rate-limiting enzyme of the polyol pathway. Expression of AKR1B1 was the highest in lens and retina. It is the first enzyme in the polyol pathway through which glucose is converted to sorbitol which is important for the function of various organs in the body, and has been implicated in the etiology of diabetic complications. AKR1B1 is quite abundant in the collecting tubule cells and thought to provide protection against hypertonic environment. Some human tissues contain AKR1B1 as well as AKR1B10, a closely related member of the aldo-keto reductase superfamily. 

References
  • Huang SP, et al. (2010) Aldo-Keto Reductases in the Eye. Journal of Ophthalmology. 326 (3): 625-36.
  • Aida K, et al. (2000) Disruption of Aldose Reductase Gene (Akr1b1) Causes Defect in Urinary Concentrating Ability and Divalent Cation Homeostasis. Biochemical and Biophysical Research Communications.277 (2): 281-6.
  • Liao CS, et al. (2009) Regulation of AKR1B1 by thyroid hormone and its receptors. Molecular and Cellular Endocrinology. 307 (1-2): 109-17.
  • Baba SP, et al. (2009) Posttranslational glutathiolation of aldose reductase (AKR1B1): A possible mechanism of protein recovery from S-nitrosylation. Chemico-Biological Interactions. 178 (1-3): 250-8.
  • Size / Price
    Catalog: HG11294-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"