After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PCNA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PCNA cDNA Clone Product Information
NCBI RefSeq:NM_011045.2
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Mus musculus proliferating cell nuclear antigen.
Gene Synonym:Pcna
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Proliferating Cell Nuclear Antigen (PCNA) is a protein only expresse in nomal proliferate cells and cancer cells. It is central to both DNA replication and repair. One of the well-established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon. PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis. Two forms of PCNA exist in cells: (i) a detergent-insoluble trimeric form stably associated with the replicating forks during S phase and (ii) a soluble form in quiescent cells in G1 and G2 phases. PCNA forms a toroidal trimer in S phase with replication factor-C (RF-C) and DNA in an ATP-dependent manner and enables the loading of DNA polymerase delta and epsilon onto the complex. The close association of PCNA with kinase complexes involved in cell cycle machinery indicates that PCNA has a regulatory role in cell cycle progression. PCNA also participates in the processing of branched intermediates that arise during the lagging strand DNA synthesis.

References
  • Balajee AS, et al. (2001) Chromatin-bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells. Nucleic Acids Res. 29 (6): 1341-51.
  • Ducoux M, et al. (2001) Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21(Cip1)-like PCNA-binding motif present in the third subunit of human DNA polymerase delta. J Biol Chem. 276 (52): 49258-66.
  • Tetsuo I, et al. (2002) PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA. Genes Cells. 7(10): 997-1007.
  • Size / Price
    Catalog: MG51906-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"