Quick Order

Mouse RNASEH2B natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse RNASEH2B cDNA Clone Product Information
NCBI RefSeq:NM_026001.2
RefSeq ORF Size:927bp
cDNA Description:Full length Clone DNA of Mus musculus ribonuclease H2, subunit B.
Gene Synonym:Dleu8, 1110019N06Rik, 2610207P08Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG51889-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"