Quick Order

Text Size:AAA

Mouse PSPH natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PSPH cDNA Clone Product Information
Gene_bank_ref_id:NM_133900.4
RefSeq ORF Size:678bp
cDNA Description:Full length Clone DNA of Mus musculus phosphoserine phosphatase.
Gene Synonym:PSP; PSPase; AI480570
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Phosphoserine phosphatase (PSPH) belongs to a subfamily of the phosphotransferases. PSPH is the rate-limiting enzyme in l-serine biosynthesis. It has previously been found that Phosphoserine phosphatase (PSPH) plays a role in epidermal homeostasis. Phosphoserine phosphatase (PSP) catalyzes the hydrolysis of phosphoserine to serine. Phosphoserine phosphatase (PSPH) expression has been examined in human-mouse somatic cell hybrids retaining different combination of human chromosomes. Phosphoserine phosphatase (PSPH) is expressed throughout the proliferative layer of the epidermis and hair follicles in rodent and human skin and is highly induced in SCC. In keratinocytes, Phosphoserine phosphatase (PSPH) is a cytoplasmic protein that primarily localizes to endosomes and is present primarily as a homodimer. Knock down of Phosphoserine phosphatase (PSPH) dramatically diminished SCC cell proliferation and cyclin D1 levels in the presence of exogenous of l-serine production suggesting a non-canonical role for Phosphoserine phosphatase (PSPH) in epithelial carcinogenesis. Phosphoserine phosphatase (PSPH) is highly induced in proliferative normal keratinocytes and in skin tumors. Phosphoserine phosphatase (PSPH) appears to be critical for the proliferation of SCC cells; however, this phenomenon may not involve the phosphoserine metabolic pathway.

References
  • Bachelor MA, et al. (2011) L-3-Phosphoserine phosphatase (PSPH) regulates cutaneous squamous cell carcinoma proliferation independent of L-serine biosynthesis. J Dermatol Sci. 63(3): 164-72.
  • Koch GA, et al. (1983) Assignment of the human phosphoserine phosphatase gene (PSP) to the pter leads to q22 region of chromosome 7. Cytogenet Cell Genet. 35(1): 67-9.
  • Jaeken J, et al. (1997) Phosphoserine phosphatase deficiency in a patient with Williams syndrome. J Med Genet. 34(7): 594-6.
  • Size / Price
    Catalog: MG51854-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"