Quick Order

Text Size:AAA

Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIST1H3AcDNA Clone Product Information
cDNA Size:411
cDNA Description:ORF Clone of Homo sapiens histone cluster 1, H3a DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11231-ACG$325
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11231-ACR$325
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11231-ANG$325
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11231-ANR$325
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11231-CF$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11231-CH$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11231-CM$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11231-CY$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone)HG11231-M$95
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11231-M-N$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11231-NF$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11231-NH$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11231-NM$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11231-NY$295
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11231-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Histone H3.1, also known as HIST1H3A, HIST1H3B, HIST1H3C, HIST1H3D, HIST1H3E, HIST1H3F, HIST1H3G, HIST1H3H, HIST1H3I, HIST1H3J, is a member of the histone H3 family which is a core component of nucleosome. It is expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures.

  • Lachner M, et al., 2001, Nature 410 (6824): 116-20.
  • Koessler H, et al., 2003, DNA Cell Biol. 22 (4): 233-41.
  • Macdonald N. et al., 2005, Mol. Cell 20: 199-211.
  • Hyllus D. et al., 2007, Genes Dev. 21: 3369-3380.
  • Garcia BA. et al., 2007, J. Biol. Chem. 282:7641-7655.
  • Yu L.-R. et al., 2007, J. Proteome Res. 6: 4150-4162.