Quick Order

Text Size:AAA

Mouse PHGDH natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse PHGDH cDNA Clone Product Information
NCBI RefSeq:AK169684.1
RefSeq ORF Size:1602bp
cDNA Description:Full length Clone DNA of Mus musculus 3-phosphoglycerate dehydrogenase.
Gene Synonym:A10; PGD; PGAD; PGDH; SERA; 3PGDH; 3-PGDH; 4930479N23
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PHGDH is a member of the D-isomer specific 2-hydroxyacid dehydrogenase family. This new family consists of D-isomer-stereospecific enzymes. The conserved residues in this family appear to be the residues involved in the substrate binding and the catalytic reaction, and thus to be targets for site-directed mutagenesis. A number of NAD-dependent 2-hydroxyacid dehydrogenases which seem to be specific for the D-isomer of their substrate have been shown to be functionally and structurally related. PHGDH catalyzes the transition of 3-phosphoglycerate into 3-phosphohydroxypyruvate, which is the first and rate-limiting step in the phosphorylated pathway of serine biosynthesis, using NAD+/NADH as a cofactor. Overexpression of PHGDH may cause certain breast cancers. Defects in PHGDH are the cause of phosphoglycerate dehydrogenase deficiency which is characterized by congenital microcephaly, psychomotor retardation, and seizures.

References
  • Pind S, et al. (2002) V490M, a common mutation in 3-phosphoglycerate dehydrogenase deficiency, causes enzyme deficiency by decreasing the yield of mature enzyme. J Biol Chem. 277 (9): 7136-43.
  • Du H, et al. (2010) 3-Phosphoglycerate dehydrogenase expression is regulated by HOXA10 in murine endometrium and human endometrial cells. Reproduction. 139 (1): 237-45.
  • Possemato R, et al. (2011) Functional genomics reveal that the serine synthesis pathway is essential in breast cancer. Nature. 476 (7360): 346-50.
  • Size / Price
    Catalog: MG51754-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"