After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CDKL2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDKL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_003948.3
RefSeq ORF Size:1482bp
cDNA Description:Full length Clone DNA of Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase) with C terminal Flag tag.
Gene Synonym:P56, KKIAMRE, CDKL2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is found expressed in various brain regions, including the cerebral cortex, entorinal cortex, hippocampus, amygdala, and dorsal thalamus. The high expression in these brain regions suggests that Cdkl2 may have functions in congnition and emotion processes. Cdkl2 accumulates primarily in the cytoplasm, with lower levels in the nucleus.

References
  • Sassa T, et al. (2003) Postnatal expression of Cdkl2 in mouse brain revealed by LacZ inserted into the Cdkl2 locus. Cell and Tissue Research. 315 (2): 147-56.
  • Rosenblatt J, et al. (1992) Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. PNAS. 89 (7): 2824-8.
  • Mironov V, et al. (1999) Cyclin-Dependent Kinases and Cell Division in Plants-The Nexus. The Plant Cell. 11 (4): 509-22.
  • Size / Price
    Catalog: HG11191-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"