After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CADM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CADM1cDNA Clone Product Information
cDNA Size:1329
cDNA Description:ORF Clone of Homo sapiens cell adhesion molecule 1 DNA.
Gene Synonym:BL2, ST17, IGSF4, NECL2, RA175, TSLC1, IGSF4A, Necl-2, SYNCAM, sgIGSF, sTSLC-1, synCAM1, MGC51880, MGC149785, DKFZp686F1789, CADM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.

  • Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.
  • Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.
  • Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.
  • Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items