Quick Order

Mouse CFL2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CFL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_007688.2
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Mus musculus cofilin 2, muscle.
Gene Synonym:Cfl2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein superfamily. Cofilin2 shows significant homology to the other two members: cofilin 1 and DSTN, through its entire sequence, and contains residues conserved among the cofilin family that are responsible for actin-binding. Cofilin 2 (CFL2) is an important regulator of striated myocyte function. Purified cofilin 2 depolymerized actin filaments in a dose- and pH-dependent manner and reduced the apparent viscosity of an actin solution, although they did not co-sediment with actin filaments at all. Cofilin2 is not expressed in vegetative cells, but is transiently induced during the aggregation stage of development, whereas cofilin 1 was predominantly expressed in vegetative cells. 

References
  • Aizawa H, et al. (2001) Cofilin-2, a novel type of cofilin, is expressed specifically at aggregation stage of Dictyostelium discoideum development. Genes Cells. 6 (10): 913-21.
  • Papalouka V, et al. (2009) Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Papalouka V, Mol Cell Biol. 29 (22): 6046-58.
  • Size / Price
    Catalog: MG51672-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"