After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SMNDC1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SMNDC1 cDNA Clone Product Information
Gene_bank_ref_id:NM_172429.2
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of Mus musculus survival motor neuron domain containing 1.
Gene Synonym:2410004J23Rik, 4933440I19Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

SMNDC1 gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. SMNDC1 is a nuclear protein that has been identified as a constituent of the spliceosome complex. SMNDC1 gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. SMNDC1 is necessary for spliceosome assembly. Its overexpression causes apoptosis.

References
  • Rappsilber J, et al. (2001) SPF30 is an essential human splicing factor required for assembly of the U4/U5/U6 tri-small nuclear ribonucleoprotein into the spliceosome. J Biol Chem. 276(33): 31142-50.
  • Talbot K, et al. (1999) Characterization of a gene encoding survival motor neuron (SMN)-related protein, a constituent of the spliceosome complex. Hum Mol Genet. 7(13): 2149-56.
  • Neubauer G, et al. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 20(1):46-50.
  • Size / Price
    Catalog: MG51666-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"