Quick Order

Text Size:AAA

Mouse MTFR1L natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse MTFR1L cDNA Clone Product Information
NCBI RefSeq:BC026808.1
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Mus musculus mitochondrial fission regulator 1-like.
Gene Synonym:Fam54b, AI480750, 2410166I05Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG51657-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"