Quick Order

Text Size:AAA

Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A11cDNA Clone Product Information
Gene_bank_ref_id:NM_005620.1
cDNA Size:318
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A11 DNA.
Gene Synonym:MLN70, S100C, S100A11
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11140-ACG$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11140-ACR$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11140-ANG$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11140-ANR$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11140-CF$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11140-CH$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11140-CM$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11140-CY$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone)HG11140-M$95
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11140-M-F$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11140-NF$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11140-NH$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11140-NM$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11140-NY$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11140-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"