Quick Order

Human AACS Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AACScDNA Clone Product Information
Gene_bank_ref_id:NM_023928.3
cDNA Size:2019
cDNA Description:ORF Clone of Homo sapiens acetoacetyl-CoA synthetase DNA.
Gene Synonym:ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.

References
  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • Size / Price
    Catalog:HG11117-CF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"