Quick Order

Human IGF2BP2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IGF2BP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_006548.4
RefSeq ORF Size:1800bp
cDNA Description:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 mRNA binding protein 2 with C terminal Flag tag.
Gene Synonym:p62, IMP2, IMP-2, VICKZ2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Background

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

References
  • Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.
  • Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.
  • Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.
  • Size / Price
    Catalog: HG11116-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"