Quick Order

Mouse EIF2S2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse EIF2S2 cDNA Clone Product Information
Gene_bank_ref_id:NM_026030.2
RefSeq ORF Size:996bp
cDNA Description:Full length Clone DNA of Mus musculus eukaryotic translation initiation factor 2, subunit 2 (beta).
Gene Synonym:EIF2, 38kDa, EIF2B, AA408636, AA571381, AA986487, AW822225, D2Ertd303e, 2810026E11Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG51543-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"