Quick Order

Human SMYD2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SMYD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_020197.2
RefSeq ORF Size:1302bp
cDNA Description:Full length Clone DNA of Homo sapiens SET and MYND domain containing 2 with C terminal Flag tag.
Gene Synonym:KMT3C, HSKM-B, ZMYND14, MGC119305, SMYD2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SET and MYND domain-containing protein 2, also known as HSKM-B, SMYD2, and KMT3C, is a member of the SMYD protein family. It contains one MYND-type zinc finger and one SET domain. Not much is known about SMYD2. However, the interest in better understanding the roles of SMYD2 has grown because of reports indicating that SMYD2 methylates p53 and histone H3. In Xenopus, SMYD1 and SMYD2 were expressed in various muscle tissues and related to muscle cells differentiation. SMYD2 mRNA is most highly expressed in heart and brain tissue. Over-expressed SMYD2 localizes to the cytoplasm and the nucleus in 293T cells. SMYD2 appears to restrain cell proliferation, likely through direct modulation of chromatin structure. Patients with SMYD2-overexpressing tumors had a worse overall rate of survival than those with non-expressing tumors, and SMYD2 positivity was independently associated with a worse outcome in the multivariate analysis. SMYD2 plays an important role in tumor cell proliferation through its activation/overexpression and regards as a prognosticator and potential therapeutic target in esophageal squamous cell carcinoma (ESCC).

Size / Price
Catalog: HG11093-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"